The Mykrobe parser seems to be parsing resistance variants as resistance genes.

For instance is katG_S315T from the test output file is being parsed as a gene and not a variant.

katG is the gene the the variant is on? Or should I remove this entirely?

Yes, katG is the gene name where the mutation was found.

Mykrobe report variants with the following format

The variants column contains entries usually in the format _-:::. For example, rpsL_K43R-AAG781686AGG:0:513:3132 means K to R amino acid change at position 43 in the rpsL gene, which is AGG to AAG at position 781686 in the genome, with 0 reads supporting the reference, 513 depth on the alternative allele, and a genotype confidence of 3132.

https://github.com/Mykrobe-tools/mykrobe/wiki/AMR-prediction-output

Yes, katG is the gene name where the mutation was found.

Mykrobe report variants with the following format

The variants column contains entries usually in the format _-:::. For example, rpsL_K43R-AAG781686AGG:0:513:3132 means K to R amino acid change at position 43 in the rpsL gene, which is AGG to AAG at position 781686 in the genome, with 0 reads supporting the reference, 513 depth on the alternative allele, and a genotype confidence of 3132.

https://github.com/Mykrobe-tools/mykrobe/wiki/AMR-prediction-output

No I understand that, just wondering if you mean that I must only report a variant in mykrobe's case?

Its getting closer.

The parser cant handle when there are multiple variants yielding the same resistance. For instance Rifampicin resistance in the test file,

mykrobe report that it is caused by three deletions,

• rpoB_TCATGGA1298T-TCATGGA761104T:152:2108:14397
• rpoB_TTCATGGA1297TT-TTCATGGA761103TT:303:1978:13279
• rpoB_CTGAGCCAATTCATGGACCAGAACAACCC1288CTGAGCCAATTCCAGAACAACCC-CTGAGCCAATTCATGGACCAGAACAACCC761094CTGAGCCAATTCCAGAACAACCC:1:2505:16677

The current iteration of the parser only reports one variant

{'alt_aa': None,
 'alt_nt': 'T',
 'annotation': None,
 'ass_end_pos': None,
 'ass_start_pos': None,
 'change': 'TCATGGA1298T',
 'close_seq_name': None,
 'contig_id': None,
 'depth': 16677.0,
 'drugs': ['rifampicin'],
 'element_subtype': None,
 'element_type': 'AMR',
 'gene_symbol': 'rpoB',
 'method': 'kmer_count',
 'nucleotide_change': 'c.TCATGGA761104T',
 'phenotypes': [],
 'position': 761104,
 'protein_change': 'p.TCATGGA1298T',
 'ref_aa': None,
 'ref_database': None,
 'ref_id': None,
 'ref_nt': 'TCATGGA',
 'res_class': None,
 'res_subclass': None,
 'sequence_name': None,
 'strand': None,
 'target_length': None,
 'type': None,
 'variant_type': 'deletion'}

Solved!